Donate!
Welcome, Guest. Please Login or Register :: View Members
Pages: 1 2 3 
Send Topic Print
And everyone is just Baffled.. (Read 146 times)
justin_o_guy2
Serious Thumper
*****
Offline

What happened?

Posts: 55279
East Texas, 1/2 dallas/la.
And everyone is just Baffled..
02/02/23 at 05:15:02
 
Back to top
 
 

The people never give up their liberties but under some delusion.- Edmund Burke.
  IP Logged
zevenenergie
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 1783
The Netherlands   Den Haag
Re: And everyone is just Baffled..
Reply #1 - 02/02/23 at 06:03:51
 
And the vaccine also causes cancer.
University research has shown that the vaccine does enter the DNA. And there the ability to correct mistakes in multiplication is damaged. Resulting in cancer.

So every time you hit a booster you play roulette.
Here's the link to the news.

https://www.youtube.com/watch?v=4Unt03UBhbU

And if you want I will find you the whole investigation with all the details.

Shortly thereafter, it was denied by big pharma and dismissed as a conspiracy. But the research stands.
And several investigations followed.
Like this one from 2 months ago.

https://www.youtube.com/watch?v=uxoL3Fy93Ro

The covid scam is easy to see if you look a little deeper than what is being said in the media and on various platforms.

The established health care system readily accepts the advice that is handed to it from above.
That's their internal structure.
So it can happen that an information officer is selling the really questionable statement that the vaccine is safe.

While he himself is 100% convinced that it is save.




Back to top
 
 

Do what you know is right. (you can always use fear as a counselor later)
  IP Logged
justin_o_guy2
Serious Thumper
*****
Offline

What happened?

Posts: 55279
East Texas, 1/2 dallas/la.
Re: And everyone is just Baffled..
Reply #2 - 02/02/23 at 06:21:17
 
I was Wrong about the jabs. I knew I wouldn't ever take it. I knew it wasn't going to be good. But I'm shocked at just how awful it is and how many are Still Pushing it.
Trump Seriously needs to admit they are bad and stfu about telling people to take them.
Back to top
 
 

The people never give up their liberties but under some delusion.- Edmund Burke.
  IP Logged
zevenenergie
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 1783
The Netherlands   Den Haag
Re: And everyone is just Baffled..
Reply #3 - 02/02/23 at 06:36:05
 
He can not do that. The denial of all the problems surrounding the whole covid thing is too great.
The illusion that has been erected is too strong.
And because we all live in a kind of illusion, we consciously or unconsciously choose the safest side.

It works like this:

Keep your mouth shut. You’re probably being filmed and it’s gonna show up on Twitter and websites across the world. You’ll be looking for a job before the end of the day and for the rest of your life this will follow you around.
Back to top
 
 

Do what you know is right. (you can always use fear as a counselor later)
  IP Logged
zevenenergie
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 1783
The Netherlands   Den Haag
Re: And everyone is just Baffled..
Reply #4 - 02/02/23 at 07:07:18
 
In every tradition based on awakening (enlightenment) it is said that it is not without danger.

Once you rebel. Like jesus Socrates and many many others did (Resently Bagwan) You are in danger.

Of course I'm not saying that Trump is enlightened or anything (it's obvious he isn't) but I just want to point out how dangerous it is when you rebel against the established order.

An enlightened can do nothing about it.
He or she has fallen together with god. They can only be completely spontaneous. the word compromise does not exist for them. never will they deny god.
He or she literally can't help to rebel. There very being is a insult to how we live.

That's also why the taboo on seeking enlightenment is so big. You better be a gay than a seeker of truth.

That is also the reason that, for example, Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.
And in turn, Serowbot also highlights our illutions. Because there are plenty of them.

Don't forget that the entire conspiracy community is also going wrong on many fronts.
There is no other way, because we all live in the illusion that we are someone, with an identity.

And we defend that identity to death. That's how strong the illusion is.

And by truth, of course, I don't mean certain theories, or images or facts.


It's nobody,s fault. Nobody's because this is a collective illusion.
And collective illusions are very, very strong. You have to think for a moment that the whole of humanity thinks all day long.
Maybe you can imagine how strong the force field is.

I think I'm a bit off topic....
Back to top
 
 

Do what you know is right. (you can always use fear as a counselor later)
  IP Logged
Serowbot
YaBB Moderator
ModSquad
*****
Offline

OK.... so what's the
speed of dark?

Posts: 29287
Tucson Az
Gender: male
Re: And everyone is just Baffled..
Reply #5 - 02/02/23 at 07:37:34
 
zevenenergie wrote on 02/02/23 at 07:07:18:
Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

There is position A, and there is position B...
If you can admit ignorance in biological science, the smart move is to believe those with the knowledge you don't have.  The other option is to think  yourself wiser than experts.
Do you think that's smart?
Back to top
 
 

Ludicrous Speed !... ... Huh...
  IP Logged
splash07
Serious Thumper
*****
Offline



Posts: 911
Charleston, SC
Gender: male
Re: And everyone is just Baffled..
Reply #6 - 02/02/23 at 07:54:29
 
Serowbot wrote on 02/02/23 at 07:37:34:
zevenenergie wrote on 02/02/23 at 07:07:18:
Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

There is position A, and there is position B...
If you can admit ignorance in biological science, the smart move is to believe those with the knowledge you don't have.  The other option is to think  yourself wiser than experts.
Do you think that's smart?



Well said, but you can't argue the merits of science with people who don't know what science is.
Back to top
 
 

  IP Logged
justin_o_guy2
Serious Thumper
*****
Offline

What happened?

Posts: 55279
East Texas, 1/2 dallas/la.
Re: And everyone is just Baffled..
Reply #7 - 02/02/23 at 08:07:40
 
When Experts disregard Natural Immunity, I'm smarter.
If students were Not smarter than teacher,society would never move forward.
The Experts running things are FUKKING UP HORRIBLY.
Yeah, I'm smarter.

You better be a gay than a seeker of truth.

Saying the quiet part out loud..
Back to top
 
 

The people never give up their liberties but under some delusion.- Edmund Burke.
  IP Logged
zevenenergie
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 1783
The Netherlands   Den Haag
Re: And everyone is just Baffled..
Reply #8 - 02/02/23 at 08:56:29
 
Serowbot wrote on 02/02/23 at 07:37:34:
zevenenergie wrote on 02/02/23 at 07:07:18:
Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

There is position A, and there is position B...
If you can admit ignorance in biological science, the smart move is to believe those with the knowledge you don't have.  The other option is to think  yourself wiser than experts.
Do you think that's smart?


RESPONSE:

First read the research from the Stockholm University.
And then I can tell from your reaction whether you see me, or whether you let your prejudices speak.



first_page
settings
Order Article Reprints
Open AccessArticle
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro
by Hui Jiang
1,2,* and Ya-Fang Mei
2,*
1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umeå University, SE-90185 Umeå, Sweden
*
Authors to whom correspondence should be addressed.
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021 / Retracted: 10 May 2022
(This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions)
Download Browse Figures
Versions Notes

Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.
Keywords:
SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine

1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.
2. Materials and Methods
2.1. Antibodies and Reagents
DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and β-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), γ–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5′–CACAGTGCTACAGACTGGAACAAAAACC–3′. 23–spacer RSS sequence: 5′–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3′. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].
2.3. Cells and Cell Culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100 μg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.
2.4. HR and NHEJ Reporter Assays
HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 μg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cellular Fractionation and Immunoblotting
For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 μm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 μg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).
2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.
2.8. Analysis of V(D)J Recombination
Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.
2.9. Statistical Analysis
All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.
3. Results
3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair
DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the
Back to top
 
 

Do what you know is right. (you can always use fear as a counselor later)
  IP Logged
justin_o_guy2
Serious Thumper
*****
Offline

What happened?

Posts: 55279
East Texas, 1/2 dallas/la.
Re: And everyone is just Baffled..
Reply #9 - 02/02/23 at 09:14:32
 
Back to top
 
 

The people never give up their liberties but under some delusion.- Edmund Burke.
  IP Logged
WebsterMark
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 13896

Gender: male
Re: And everyone is just Baffled..
Reply #10 - 02/02/23 at 10:09:02
 
Serowbot wrote on 02/02/23 at 07:37:34:
zevenenergie wrote on 02/02/23 at 07:07:18:
Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

There is position A, and there is position B...
If you can admit ignorance in biological science, the smart move is to believe those with the knowledge you don't have.  The other option is to think  yourself wiser than experts.
Do you think that's smart?


History is full of instances where yes, those who questioned the experts were proven correct, smarter if you will, and we are all the better for it.

Our issue today is “science” is used as a political hammer and those whose “science” differs from whichever class is in control of a situation at the moment, swings that hammer.

Global warming is a classic example. Miami was supposed to be underwater by now. But the funny thing is all of those experts who made those predictions that never even remotely came close to being true are still listened to as experts today. I just saw that Paul Erlich guy of the population bomb was on TV the other day still talking about it, and he was being listened to as if he were in authority on the topic.

Those who disagree and say  “my data doesn’t support that” are labeled as heretics, crazies, tinfoil hat, conspiracies, stupid or on the take for money from the other side. The other side is full of scientist, professors, researchers and professional speakers, who make a ridiculously comfortable living yet somehow they never have to answer those questions about monetary motive.

The one thing we should all know for sure is that the vaccines were overhyped for political purposes by both sides, but way more on the Democratic side. A lot of people made an awful lot of money off the vaccines, that’s another thing we should all agree to. And we should all agree, that the reputation of our health agencies suffered because they were manipulated for political purposes, both of their own doings in by outside, national political figures.
Back to top
 
 
  IP Logged
Eegore
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 9102

Re: And everyone is just Baffled..
Reply #11 - 02/02/23 at 10:17:03
 

First read the research from the Stockholm University.
And then I can tell from your reaction whether you see me, or whether you let your prejudices speak.



 There are many things questionable with concluding that this laboratory study is an analogue for what happens to an injected medium.  Lets start there.

 How are you creating a similar, let alone identical assessment of in vitro high protein saturation to normal/natural protein injections in regards to how BRCA 1 impedes regular bonding?
Back to top
 
 
  IP Logged
Eegore
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 9102

Re: And everyone is just Baffled..
Reply #12 - 02/02/23 at 10:20:44
 

Take it up with the Doctor...


 You mean the One doctor that can't seem to read the DCEM correctly?  Every other doctor in the military, of which many are anti-mandate is an idiot?

 Maybe we can add her to your list of 200+ disabled military staff per-day.

 As for the original article, why would you expect a 66 year old who died from cancer to be on the list of "Active Athletes" in Spain?  Of course when you start combining 20 year old active athletes to ones that played 45 years prior you will have higher numbers.

 58 year old racecar driver "athlete" dies unexpectedly.  Yeah lets toss this guy in the young soccer player category.  Also some of the people on that DEAD list are still alive, but that never mattered before.  And lastly how did they get those percentages without that second number?
Back to top
 
 
  IP Logged
Eegore
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 9102

Re: And everyone is just Baffled..
Reply #13 - 02/02/23 at 10:35:47
 
"The one thing we should all know for sure is that the vaccines were overhyped for political purposes by both sides, but way more on the Democratic side. A lot of people made an awful lot of money off the vaccines, that’s another thing we should all agree to. And we should all agree, that the reputation of our health agencies suffered because they were manipulated for political purposes, both of their own doings in by outside, national political figures."

 I would agree with that.  

 If people would stop grasping for any "proof" they can find that exclusively matches their opinion we could actually discuss some of this.  Another thing to understand is that a lot of money is being made on the anti-vaccine side as well.  Many of the "truth" exposing websites survive off of the links and modify their content to gain revenue, not tell the truth.  Multiple YouTube videos and social media posts were, by the creator's own admissions, made for a monetization grab and contained key words and made-up statistics.  Millions of dollars are made this way.

 Lies come from all sources, not just the one's we don't want to trust.

 
Back to top
 
 
  IP Logged
zevenenergie
Serious Thumper
*****
Offline

SuzukiSavage.com
Rocks!

Posts: 1783
The Netherlands   Den Haag
Re: And everyone is just Baffled..
Reply #14 - 02/02/23 at 11:11:08
 
Eegore wrote on 02/02/23 at 10:17:03:

First read the research from the Stockholm University.
And then I can tell from your reaction whether you see me, or whether you let your prejudices speak.



 There are many things questionable with concluding that this laboratory study is an analogue for what happens to an injected medium.  Lets start there.

 How are you creating a similar, let alone identical assessment of in vitro high protein saturation to normal/natural protein injections in regards to how BRCA 1 impedes regular bonding?


I don't quite understand your question.

Variants of uncertain significance fundamentally limit the clinical utility of genetic information. The challenge they pose is epitomized by BRCA1, a tumour suppressor gene in which germline loss-of-function variants predispose women to breast and ovarian cancer. Although BRCA1 has been sequenced in millions of women, the risk associated with most newly observed variants cannot be definitively assigned. Here we use saturation genome editing to assay 96.5% of all possible single-nucleotide variants (SNVs) in 13 exons that encode functionally critical domains of BRCA1. Functional effects for nearly 4,000 SNVs are bimodally distributed and almost perfectly concordant with established assessments of pathogenicity. Over 400 non-functional missense SNVs are identified, as well as around 300 SNVs that disrupt expression. We predict that these results will be immediately useful for the clinical interpretation of BRCA1 variants, and that this approach can be extended to overcome the challenge of variants of uncertain significance in additional clinically actionable genes.



Back to top
 
 

Do what you know is right. (you can always use fear as a counselor later)
  IP Logged
Pages: 1 2 3 
Send Topic Print


« Home

 
« Home
SuzukiSavage.com
05/17/25 at 12:29:33



General CategoryPolitics, Religion (Tall Table) › And everyone is just Baffled..


SuzukiSavage.com » Powered by YaBB 2.2!
YaBB © 2000-2007. All Rights Reserved.